Readset File¶
Readsets refer to replicates that belong to a particular sample. If a sample was divided over 3 lanes, each lane output would be a readset of that sample. Most pipelines merge readsets and run the analysis based on samples. You can think of readsets as technical replicates while Samples as biological replicates.
Note
Why does GenPipes need Readset file?
A readset file is another file that accompanies our pipelines. While the configuration files contains information about the parameters needed by the tools in the pipeline, the readset file contains information about the samples to be analyzed. In the Readset file, you list each readset used for the analysis, which samples are to be merged and where your fastq files or bam files are located.
Readset File format¶
Warning
Readset file format may vary for different GenPipes Pipelines. For example, ChIP-Seq, PacBio and Nanopore pipelines use a slightly different readset format as compared to DNA-Seq, RNA-Seq or Covseq pipelines.
General Readset File Format¶
The general readset file format is meant for the following pipelines only. Refer to other pipeline specific readset file format in the subsequent sections if it does not belong to the list below:
DNA-Seq high Coverage,
RNA-Seq,
RNA-Seq De Novo Assembly,
Amplicon-Seq,
Tumor Pair,
Methyl-Seq,
CovSeq
For the pipelines listed above, the readset file is a tab-separated file that contains the information in the table below:
Field |
Contents |
---|---|
Sample: |
Sample must contain letters A-Z, numbers 0-9, hyphens (-) or underscores (_) only; BAM files will be merged into a file named after this value; mandatory. Note: The definition of a sample in the context of GenPipes is the “input” biological sample, i.e. the sample on which processing such as IP, IgG assay (ChIPSeq Pipeline) or nothing (input) was performed. This is in contrast to sample being defined as the “sample sent for sequencing”. |
Readset: |
a unique readset name with the same allowed characters as above; mandatory. |
Library: |
optional. |
RunType: |
PAIRED_END or SINGLE_END; mandatory. |
Run: |
mandatory. |
Lane: |
mandatory. |
Adapter1: |
sequence of the forward trimming adapter |
Adapter2: |
sequence of the reverse trimming adapter |
QualityOffset: |
quality score offset integer used for trimming; optional. |
BED: |
relative or absolute path to BED file; optional. |
FASTQ1: |
relative or absolute path to first FASTQ file for paired-end readset or single FASTQ file for single-end readset; mandatory if BAM value is missing. |
FASTQ2: |
relative or absolute path to second FASTQ file for paired-end readset; mandatory if RunType value is “PAIRED_END”. |
BAM: |
relative or absolute path to BAM file which will be converted into FASTQ files if they are not available; mandatory if FASTQ1 value is missing, ignored otherwise. |
Note
If some optional information is missing, leave its position empty.
Example of Readset File¶
Sample Readset Library RunType Run Lane Adapter1 Adapter2 QualityOffset BED FASTQ1 FASTQ2 BAM
sampleA readset1 lib0001 PAIRED_END run100 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset1.paired1.fastq.gz path/to/readset1.paired2.fastq.gz path/to/readset1.bam
sampleA readset2 lib0001 PAIRED_END run100 2 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset2.paired1.fastq.gz path/to/readset2.paired2.fastq.gz path/to/readset2.bam
sampleB readset3 lib0002 PAIRED_END run200 5 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset3.paired1.fastq.gz path/to/readset3.paired2.fastq.gz path/to/readset3.bam
sampleB readset4 lib0002 PAIRED_END run200 6 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset4.paired1.fastq.gz path/to/readset4.paired2.fastq.gz path/to/readset4.bam
ChIP-Seq Pipeline Readset File Format¶
Use the following readset file format for the ChIP-Seq Pipeline. Do NOT use the general readset file format above for ChIP-Seq pipeline.
Field |
Contents |
---|---|
Sample: |
Sample must contain letters A-Z, numbers 0-9, hyphens (-) or underscores (_) only; BAM files will be merged into a file named after this value; mandatory. Note: The definition of a sample in the context of GenPipes is the “input” biological sample, i.e. the sample on which processing such as IP, IgG assay (ChIPSeq Pipeline) or nothing (input) was performed. This is in contrast to sample being defined as the “sample sent for sequencing”. |
Readset: |
a unique readset name with the same allowed characters as above; mandatory. |
MarkName: |
Name of the histone mark; mandatory |
MarkType: |
Type of mark for MACS2 calling. It must be either B (Broad), N (Narrow) or I (Input); mandatory |
Library: |
optional. |
RunType: |
PAIRED_END or SINGLE_END; mandatory. |
Run: |
mandatory. |
Lane: |
mandatory. |
Adapter1: |
sequence of the forward trimming adapter |
Adapter2: |
sequence of the reverse trimming adapter |
QualityOffset: |
quality score offset integer used for trimming; optional. |
BED: |
relative or absolute path to BED file; optional. |
FASTQ1: |
relative or absolute path to first FASTQ file for paired-end readset or single FASTQ file for single-end readset; mandatory if BAM value is missing. |
FASTQ2: |
relative or absolute path to second FASTQ file for paired-end readset; mandatory if RunType value is “PAIRED_END”. |
BAM: |
relative or absolute path to BAM file which will be converted into FASTQ files if they are not available; mandatory if FASTQ1 value is missing, ignored otherwise. |
Example of ChIP-Seq Readset File¶
Sample Readset MarkName MarkType Library RunType Run Lane Adapter1 Adapter2 QualityOffset BED FASTQ1 FASTQ2 BAM
sampleA readset1 H3K27ac N lib0001 PAIRED_END run100 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset1.paired1.fastq.gz path/to/readset1.paired2.fastq.gz path/to/readset1.bam
sampleA readset2 H3K27ac N lib0001 PAIRED_END run100 2 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset2.paired1.fastq.gz path/to/readset2.paired2.fastq.gz path/to/readset2.bam
sampleB readset3 Input I lib0002 PAIRED_END run200 5 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset3.paired1.fastq.gz path/to/readset3.paired2.fastq.gz path/to/readset3.bam
sampleB readset4 Input I lib0002 PAIRED_END run200 6 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT 33 path/to/file.bed path/to/readset4.paired1.fastq.gz path/to/readset4.paired2.fastq.gz path/to/readset4.bam
PacBio Assembly Readset File Format¶
Use the following readset file format for the PacBio Assembly Pipeline. Do NOT use the general readset file format above for the PacBio Assembly.
Field |
Contents |
---|---|
Sample: |
Sample must contain letters A-Z, numbers 0-9, hyphens (-) or underscores (_) only; BAM files will be merged into a file named after this value; mandatory. |
Readset: |
A unique readset name with the same allowed characters as above; mandatory |
Smartcell: |
Mandatory. |
NbBasePairs: |
Total number of base pairs for this readset; mandatory |
EstimatedGenomeSize: |
Estimated Genome size in numbers of base pairs used to compute seeding read length cutoff; mandatory |
BAS: |
Comma-separated list of relative or absolute paths to BAS files (old PacBio format); mandatory; if BAX value is missing, ignored otherwise. |
BAX: |
Comma-separated list of relative or absolute paths to BAX files; BAX file list is used first if both BAX/BAS lists are present; mandatory if BAS value is missing. |
Example of PacBio Assembly Readset File¶
Sample Readset Smartcell NbBasePairs EstimatedGenomeSize BAS BAX
sampleA readset1 F_01_1 122169744 150000 path/to/readset1.bas.h5 path/to/readset1.1.bax.h5,path/to/readset1.2.bax.h5,path/to/readset1.3.bax.h5
sampleA readset2 F_01_2 105503472 150000 path/to/readset2.bas.h5 path/to/readset2.1.bax.h5,path/to/readset2.2.bax.h5,path/to/readset2.3.bax.h5
sampleB readset3 G_01_1 118603200 150000 path/to/readset3.bas.h5 path/to/readset3.1.bax.h5,path/to/readset3.2.bax.h5,path/to/readset3.3.bax.h5
sampleB readset4 G_01_2 104239488 150000 path/to/readset4.bas.h5 path/to/readset4.1.bax.h5,path/to/readset4.2.bax.h5,path/to/readset4.3.bax.h5
Nanopore Pipeline Readset File Format¶
Use the following readset file format for the Nanopore Pipeline. Do NOT use the general readset file format above for the Nanopore Pipeline.
Field |
Contents |
---|---|
Sample: |
Sample must contain letters A-Z, numbers 0-9, hyphens (-) or underscores (_) only; BAM files will be merged into a file named after this value; mandatory. |
Readset: |
A unique readset name with the same allowed characters as above; mandatory |
Run: |
A unique ONT run name, usually has a structure similar to PAE000_alb2c3d. |
Flowcell: |
Code of the type of flowcell used. For example, the code for PromethION Flow Cell (R9.4) is FLO-PRO002. |
Library: |
Code of the type of library preparation kit used. For example, the code for the Ligation Sequencing Kit is SQK-LSK109. |
Summary |
Path to the |
FASTQ: |
The path to the |
FAST5: |
The path to the directory containing the raw fast5 files, before basecalling. |
Example of PacBio Assembly Readset File¶
Sample Readset Run Flowcell Library Summary FASTQ FAST5
sampleA readset1 PAE00001_abcd123 FLO-PRO002 SQK-LSK109 path/to/readset1_sequencing_summary.txt path/to/readset1/fastq_pass path/to/readset1/fast5_pass
sampleA readset2 PAE00002_abcd456 FLO-PRO002 SQK-LSK109 path/to/readset2_sequencing_summary.txt path/to/readset2/fastq_pass path/to/readset2/fast5_pass
sampleA readset3 PAE00003_abcd789 FLO-PRO002 SQK-LSK109 path/to/readset3_sequencing_summary.txt path/to/readset3/fastq_pass path/to/readset3/fast5_pass
sampleA readset4 PAE00004_abcd246 FLO-PRO002 SQK-LSK109 path/to/readset4_sequencing_summary.txt path/to/readset4/fastq_pass path/to/readset4/fast5_pass
Difference between a Genome Sample File and Readset file¶
Readsets refer to replicates that belong to a particular sample. If a sample was divided over 3 lanes, each lane output would be a readset of that sample. Most pipelines merge readsets and run the analysis based on samples. You can think of readsets as technical replicates while Samples as biological replicates.
Creating a Readset File¶
If you have access to Abacus, we provide a script $MUGQIC_PIPELINES_HOME/utils/nanuq2mugqic_pipelines.py
that can access your Nanuq data, creates symlinks to the data on Abacus and creates the Readset file for you.
If your data is on nanuq but you do not have access to Abacus, there is a helper script $MUGQIC_PIPELINES_HOME/utils/csvToreadset.R
that takes a csv file downloadable from nanuq and creates the Readset file. However, you will have to download the data from Nanuq yourself.
If your data is not on nanuq, you will have to manually create the Readset file. You can use a template and enter your samples manually. Remember that it is a tab separated file. There is a helper $MUGQIC_PIPELINES_HOME/utils/mugqicValidator.py
script that can validate the integrity of your readset file.
Note
For abacus users with Nanuq readsets
If your readsets belong to a Nanuq project, use $MUGQIC_PIPELINES_HOME/utils/nanuq2mugqic_pipelines.py
script to automatically create a Readset File and symlinks to your readsets on abacus.